Přihlášené týmy

 

18
 

Do startu zbývá

Anketa

Jak se Vám líbí trailer?
Bomba, nevíme co dřív hledat
100%
Nic moc, loni byl lepší
0%
Nedá se to poslouchat, hrůza
0%
Celkem hlasů: 1

Poslední komentáře

Zadání: Soutěžní kód uvidíte na plastice lidské ruky na místě, kam vás zavede indicie5-1.

Indicie5-1 - videosoubor

Řešení: Schodiště není samozřejmě žádné schodiště, nýbrž má znázorňovat řetězec RNA. Že se jedná o RNA nikoli o DNA můžete poznat podle nápovědy „RIBO“ ukryté na jednom z černých schodů zespoda. Nápověda sekvenační chromatogram Vás pak může navést na rozklíčování barev jednotlivých bází a získání kompletního řetězce. Pokud jste video nedešifrovali, dostanete kompletní řetězec ve druhé nápovědě.

Zadání, které tedy máte v ruce, je řetězec RNA. Genetická informace je zapsaná v molekule DNA, z níž se při syntéze bílkovin přepisuje do RNA. RNA je jakási mezifáze mezi DNA a bílkovinami; je to molekula podobná DNA, ale na rozdíl od ní je výrazně kratší - odpovídá většinou jednomu genu. Genetická informace v DNA i RNA je zapsaná pomocí tzv. bází, což jsou základní stavební kameny DNA a RNA. V RNA se jedná o báze adenin (A), uracil (U), cytozin (C) a guanin (G). Jednopísmenné zkratky bazí jsou vžité a všeobecně používané. Sledu (pořadí) bazí v genu se říká sekvence a genové sekvence bývají rutinně zapisovány právě pomocí těchto zkratek. Gen je, zjednodušeně řečeno, informace kódující jeden protein. Protein se skládá z aminokyselin a jednotlivé proteiny se od sebe liší jednak tím, z jakých aminokyselin se skládají, a pak také pořadím, v jakém jsou aminokyseliny zřetězeny. Vtip je v tom, že to pořadí je kódováno v genu, a to tak, že vždy trojice (triplet) bazí jdoucích po sobě kóduje určitou aminokyselinu. Převodní tabulky na to, který triplet znamená kterou aminokyselinu, se dají najít v mnoha provedeních na internetu - jedna z nich viz níže. Pro každou aminokyselinu byly dále pro zjednodušení zápisu proteinů zavedeny zkratky (troj- a jednopísmenné). Každý gen začíná startovním tripletem AUG (pokud se nachází uprostřed genu, kóduje aminokyselinu methionin) a končí "stop tripletem" UAG (ten nekóduje nikdy nic jiného než konec genu). Pokud tedy pohlédnete na zadanou sekvenci a standardně použité barvy (proto nápověda na sekvenační chromatogram), z použitých bází A, U, G, C se dá celkem snadno usoudit, že jde o sekvenci RNA. Pak není nic jednoduššího, než si vygooglit převodní tabulku a sekvenci přepsat z RNA do pořadí aminokyselin. Víme-li, že každá aminokyselina se může značit písmenkem, pak dostaneme sled písmenek. Většina písmenek potřebných k tajence "Doktorka z domu trubačů" patří mezi existující zkratky aminokyselin. Neexistují písmena O, B, Z a U - ty jsou proto nahrazeny písmeny Q, P, S a V. Proto byl součástí zadání i klíč.

Doktorka z domu trubačů je biografický román Ilony Borské o bernartické rodačce MUDr. Vlastě Kálalové - Di Lottiové, jedné z prvních českých lékařek-žen. Založila a sedm let vedla nemocnici v Bagdádu a celkově měla pestrý, plodný, ale také nelehký život (v závěru války jí v Bernarticích vyvraždili celou rodinu). Po rozluštění měli tedy soutěžící jet do Bernartic k rodnému domu Vlasty Kálalové, text na plastice lidské ruky je: "Věrni zůstaneme"

 

aminokyseliny + zkratky kódující triplety zkratka klíč
Alanin Ala (A) GCU, GCC, GCA, GCG A A
Arginin Arg (R) CGU, CGC, CGA, CGG, AGA, AGG R R
Asparagin Asn (N) AAU, AAC N  
Cystein Cys (C) UGU, UGC C C
Fenylalanin Phe (F) UUU, UUC F  
Glutamin Gln (Q) CAA, CAG Q O
Glycin Gly (G) GGU, GGC, GGA, GGG G  
Histidin His (H) CAU, CAC H  
Kys. asparagová Asp (D) GAU, GAC D D
Kys. glutamová Glu (E) GAA, GAG E  
Isoleucin Ile (I) AUU, AUC, AUA I  
Leucin Leu (L) UUA, UUG, CUU, CUC, CUA, CUG L  
Lysin Lys (K) AAA, AAG K K
Methionin Met (M) AUG M M
Prolin Pro (P) CCU, CCC, CCA, CCG P B
Serin Ser (S) UCU, UCC, UCA, UCG, AGU, AGC S Z
Threonin Thr (T) ACU, ACC, ACA, ACG T T
Tryptofan Trp (W) UGG W  
Tyrozin Tyr (Y) UAU, UAC Y  
Valin Val (V) GUU, GUC, GUA, GUG V U
stop = UAG UAG    
start = AUG AUG    

 

Soutěžní kód: vernizustaneme

Cíl: GPS: 49°22'7.132"N, 14°23'2.641"E

 

První nápověda pro tento úkol přišla po deseti minutách : sekvenační chromatogram

Druhá nápověda pak přišla po čtyřicetipěti minutách a obsahovala kompletní řetězec RNA plus klíč:

AUGGAUCAAAAAACUCAGAGGAAGGCUUCUGACCAAAUGGUUACGCGUGUCCCCGCGUGUGUAUAG

Klíč:

  • A=A
  • C=C
  • D=D
  • K=K
  • M=M
  • P=B
  • Q=O
  • R=R
  • S=Z
  • T=T
  • V=U

Deadline: 145 minut

Poznámka: Tato indicie patřila určitě k nejnáročnějším, přesto se našly týmy, které ji rozluštily. Přiznáme se, že nás vůbec nenapadlo, že některé týmy vyrazí na okružní jízdu po rozhlednách, cílem bylo nějaké zajímavé alespoň trochu nezvyklé znázornění řetězce RNA. Speciální díky za tuto indícii patří Elišce, která je autorem a Karlovi, kterému se podařilo vytvořit takhle úžasné grafické zpracování.

 

Tabulka průběžného pořadí po vyřešení úkolu 5

Pořadí Tým Čas
1 Mrkev v Radiátoru 10:50:11
2 Dlouhý, Široký, Krátkozraký a ti druzí 10:50:41
3 Kozáci 11:20:22
4 Petřínští a spol. 11:24:00
5 MR 11:24:05
6 Simply Never 12:29:17
7 Kafky 13:06:06
8 Viribus Unitis 13:13:24
9 D-F 14:00:56
10 Praha 14:29:48
11 BBB 14:40:22

Tabulka doby řešení úkolu

Pořadí Tým Doba
1 Mrkev v Radiátoru 00:58:14
2 MR 01:27:06
3 Petřínští a spol. 01:31:17
4 Dlouhý, Široký, Krátkozraký a ti druzí 01:36:43
5 Simply Never 01:39:35
6 Kozáci 01:44:10
7 Viribus Unitis 02:53:37
8 BBB 03:07:36
9 Kafky 03:28:39
10 Praha 03:37:32
11 D-F 03:44:23

Nejvtipnější a nejzajímavější soutěžní kódy, zadané pro tento úkol:

 

  • "dna"
  • "prst"
  • "prsty"
  • "sekvenacni chromatogram"
  • "toma
  • "sroubovice
  • "nevime
  • "DOKTORKAZDO UTRUBACU
Rubrika: 

Přihlášení

Seznam galerií